First commit

This commit is contained in:
Krishna Choudhary 2020-03-20 12:31:00 -07:00
parent 1feceb9dfb
commit 255c2d894b
5 changed files with 21728 additions and 0 deletions

View file

@ -0,0 +1,2 @@
>Adapter_3_prime
AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

File diff suppressed because it is too large Load diff

View file

@ -0,0 +1,11 @@
Sample Celltype
A_1 A
A_2 A
A_3 A
A_4 A
A_5 A
B_1 B
B_2 B
B_3 B
B_4 B
B_5 B

3
intro-rna-seq/rDNA.gtf Normal file
View file

@ -0,0 +1,3 @@
NR_075284.1 local CDS 1 120 . + . gene_id NR_075284.1; transcript_id NR_075284.1;
J01859.1 local CDS 1 1541 . + . gene_id J01859.1; transcript_id J01859.1;
NR_076322.1 local CDS 1 2905 . + . gene_id NR_076322.1; transcript_id NR_076322.1;